A Novel Coronavirus from Patients with Pneumonia in China, 2019

• p. 2 Methods, Viral Diagnostic Methods

  Four lower respiratory tract samples, including bronchoalveolar-lavage fluid, were collected

• p. 4 Results, Detection and Isolation of a Novel Coronavirus

  Three bronchoalveolar-lavage samples were collected from Wuhan Jinyintan Hospital

• p. 4 Results, Detection and Isolation

  Three bronchoalveolar-lavage samples were col-

• p. 2

  Four lower respiratory tract samples, including bronchoalveolar-lavage fluid

Only the authors can say what is right here.

Judge's note: Read main p2 (crops C001-a/C001-d) and main p4 (crops C001-b/C001-c). The Methods sentence gives four lower respiratory tract samples collected from 21 December 2019 onward; the Results give three bronchoalveolar-lavage samples collected on 30 December 2019 from one hospital, and all downstream text (three patients, three genomes HB-01/HB-04/HB-05, Discussion "three patients") uses three. The two sentences are not strictly the same set (different specimen description, different dates/sites), so this is an unresolved ambiguity rather than a demonstrable numerical error: nowhere does the article say what became of the fourth lower respiratory tract sample. I searched the Supplementary Appendix (supp-01 p2) and found no sample inventory that reconciles the two counts; supp-02 contains only ICMJE disclosure forms.

Second check: another model agreed

• p. 2 ICMJE form, Zhu, Section 2

  Did you or your institution at any time receive payment or services from a third party (government, commercial, private foundation, etc.)

• p. 7 Funding statement

  This work was supported by grants from the National Key Research and Development Program of China (2016YFD0500301)

Only the authors can say what is right here.

Judge's note: I checked the crop of supp-02 p2 and the full page p32: Section 2 is checked No on both forms. The funding statement on main p7 names grants from two national programmes. The form's own instructions (supp-02 text, lines 13-19) say that funds from a third party such as "a government granting agency" should be answered "Yes". "No" is meant only for work paid for by the employing institution. The authors may count these programmes as institutional funding through China CDC; only they can say. This affects the disclosure forms only, not the scientific content, so I rate it minor and raise it as an author query.

Second check: another model agreed

• p. 4 Results, Detection and Isolation

  Two nearly full-length coronavirus sequences were obtained from bronchoalveolar-lavage fluid

• p. 4 Results, Detection and Isolation

  Complete ge-nome sequences of the three novel coronaviruses were submitted to GISAID

• p. 7 Discussion

  three complete genomes obtained in this study

• p. 7 Discussion, third paragraph

  On the basis of analysis of three complete genomes obtained in this study

Only the authors can say what is right here.

Judge's note: Read main p4 crop C005-d (the whole paragraph: "Two nearly full-length coronavirus sequences ... and one full-length sequence was obtained from a virus isolated from a patient ... Complete genome sequences of the three novel coronaviruses were submitted to GISAID") and main p7 crops C007-c/C007-d ("On the basis of analysis of three complete genomes obtained in this study"). The same three sequences are described both as two nearly full-length plus one full-length and as three complete genomes, in adjacent sentences. The Methods do describe RACE and Sanger sequencing to "fill genome gaps", which could in principle have closed them, but the article never says the two nearly full-length sequences were completed before deposition, so the descriptions are left unreconciled. This is a wording/ambiguity defect rather than a wrong number.

Second check: another model agreed

• p. 2 Real-Time RT-PCR Assay, Set I probe

  5 '- the FAM - CCGTCTGCGGTATGTGGAAAGGTTATGG - BHQ1-3'

Judge's note: I checked the crop of supp-01 p2. The page image shows the stray word "the" inside the Set I probe notation. The Set II probe is written without it. This is cosmetic: the sequence itself is not affected.

Second check: none (judge only)

• p. 4 Results, Detection and Isolation, column 2

  beating was seen with light microcopy in the

• p. 4 Detection and Isolation, paragraph 2

  seen with light microcopy in the

• p. 4

  light microcopy in the

Judge's note: Read main p4 crops C008-a and C008-b: the words "light microcopy" are clearly legible in the page image, so this is not a text-extraction artefact. The correct spelling "light microscopy" is used elsewhere in the same article (Methods, "monitored daily with light microscopy", and the preceding paragraph on the same page, "examined with light microscopy daily"), confirming a simple typo.

Second check: none (judge only)

• p. 6 Figure 4B, subgenus label

  Embevovirus

• p. 6 Figure 4, Panel B, neighbouring clade labels

  Merbecovirus

Judge's note: Read main p6 crop C012-a: the label reads "Embevovirus" in the page image, so it is not an extraction artefact, and it sits beside the clade of KM349744 HKU24, AY391777 OC43, MK167038 HKU1 and FJ647223 MHV-1. All four sibling subgenus labels in the same panel end in "-becovirus" (I read Sarbecovirus, Hibecovirus, Nobecovirus and Merbecovirus in crops C012-a and C005-c), which makes the intended ending internally evident. Rests on outside knowledge only for the exact accepted spelling of the subgenus name (Embecovirus); the internal parallel is sufficient to show the printed form is a typographic slip. Cosmetic severity, since the clade membership and topology shown are unaffected.

Second check: none (judge only)

• p. 6 Figure 4B, 2019-nCoV tip labels

  BetaCoV-WuhanI-VDC-HB-05-2019EPI_ISL_402121

Judge's note: Read main p6 crops C013-a, C006-c and C005-c. In the page image the red tip label plainly reads "BetaCoV-WuhanI-VDC-HB-05-2019EPI_ISL_402121", while the line immediately above reads "BetaCoV/Wuhan/IVDC-HB-01/2019|EPI_ISL_402119" with proper separators and the line above that "BetaCoV-Wuhan-IVDC-HB-04-2020". So the misplaced "I" and the missing separator are in the published figure, not in the text layer. No such identifier form occurs anywhere else in the article or the Supplementary Appendix. Cosmetic: the accession number and clade placement remain readable and correct.

Second check: none (judge only)

• p. 32 ICMJE form, Niu, Section 1 Given Name

  Peihau

• p. 33 ICMJE form, Niu, Disclosure Statement

  Dr. Peihua Niu has nothing to disclose.

Judge's note: I checked the crops and the full page p32. The Given Name field reads "Peihau". The disclosure statement on p33 reads "Dr. Peihua Niu has nothing to disclose.", and the article byline (main.txt line 85) gives "Peihua Niu". This is a misspelling on the form.

Second check: none (judge only)